Tuesday, March 31, 2020
Food safety management systems Essay Example
Food safety management systems Essay 1.1 Enterobacteriaceae An increased consciousness and a better apprehension of the nutrient industry and its associated hazards with microbiological taints have been the consequence of the broad usage of nutrient safety direction systems in Ireland. Hazard Analysis Critical Control Point ( HACCP ) is the chief nutrient safety system used throughout nutrient industries. Although this system was introduced in the 1960 s it was merely in 1998 that the EU Hygiene of foodstuffs Regulations implemented this referential in all nutrient concerns in Europe ( Food Market Exchange 2001 ) . Microbiological controls are performed to guarantee the quality and safety of the nutrient merchandises. The patterned advance in scientific discipline and microbic engineering hold given a better apprehension of nutrient production, processing and saving and the nexus between the microscopic and macroscopic universe. This relation enables micro-organisms to be exhaustively examined and evaluated. Food borne unwellnesss are the mos t widespread public wellness jobs, making societal and economic loads along with human enduring. In order to seek cut downing the hazard of such unwellnesss and nutrient poisonings, hygiene steps are required in nutrient processing environments ( Microbiological hazard appraisal 2006 ) . The presence of Enterobacteriaceae in nutrient or food-contact surfaces in such environments serves as hygiene indexs. We will write a custom essay sample on Food safety management systems specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Food safety management systems specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Food safety management systems specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Enterobacteriaceae are a big household of bacteriums that comprise of at least 34 genera, 149 species and 21 races. Cells are typically 0.3-1.8Aà µm in length. ( Blackburn day of the month? ) They are rod shaped, Gram negative facultative anaerobes and are natural dwellers of bowels in both worlds and animate beings. They are found extensively throughout the dirt, H2O, on fruit, veggies and cereals. They play a considerable function in human wellness as many pathogens fall under this household which are known to do many infective diseases. Harmonizing to Kang et Al ( 2007 ) a minute sum of 10 settlement organizing units ( CFU s ) of peculiar micro-organisms can take to life endangering infections particularly in the immune-compromised. Salmonella typhimurium is responsible for typhoid disease while Escherichia coli is a common cause of stomach flu. ( Becker et al 2008 ) . Other Enterobacteriaceae associated diseases include infirmary acquired pneumonia, blood stream infections such as bacteraemia and blood poisoning, urinary piece of land infections and intra abdominal infections ( Denton 2007 ) . Enterobacteriaceae have been preponderantly associated with nutrient pathogen eruption. As discussed by Reilly et Al ( 1988 ) 224 eruptions of salmonellosis associated with domestic fowl meat were reported in Scotland entirely between 1980 and 1985. Among the 2245 people infected 12 died. Salmonella typhimurium and Salmonella enteritis were the chief serotypes associated with the eruption. In recent old ages the serotype Enterobacter sakazakii now known as Cronobacter sakazakii been identified as an emerging pathogen. It has been found in infant milk expression and has been the cause of neonatal meningitis and sepsis. It targets immune-compromised babies and those with a low birth weight. ( Van Acker et al 2000 ) In the 1920 s coli-aerogenes ( coliform ) group was indispensable as an index in the proof of equal processing processs in the dairy industry i.e. Pasteurization of dairy merchandises. It is apparent that since the 1950 s the full Enterobacteriaceae household has been preferred over other taxons as marker beings as they are known to be better defined when it comes to their finding and the household includes more beings of significance than other households. In the 1980 s Escherichia coli was foremost used as a mention being in the monitoring of imbibing H2O supplies. ( Mossel and Stryijk 1995 ) A microbic index harmonizing to Moore and Griffith ( 2000 ) is a microorganism that is an index for the possible presence of pathogens. 1.2 Adherence of Enterobacteriaceae to surfaces. The adhesion of micro-organisms to surfaces in the nutrient industry chiefly on treating equipment is one of the major concerns in the equal control of quality and safety of nutrient merchandises. If cleansing and sanitation are deficient, micro-organisms on the surface can last by the development of a biofilm. ( Ortega et al 2009 ) . A biofilm reduces susceptibleness to disinfectant and increases polysaccharide production. The happening of a biofilm can take to post processing taint taking to a lowered shelf life of a merchandise and the transmittal of diseases. In add-on it has been known to do mechanical obstruction, damage of heat transportation, addition in unstable frictional opposition and the corrosion of metal. ( Fuster-Valls et al 2007 ) To day of the month no ideal method for finding the cleanliness of surfaces has been available. The combination of ocular, non microbial and microbiological methods can take to an integrated cleansing monitoring scheme. ( Griffith et al 1997 ) . The ability to quantify micro-organisms on nutrient contact surfaces provides indispensable information for patterning consumer exposure from cross taint in the nutrient industry through nutrient production, nutrient conveyance and in nutrient service environments. Many infective bacteriums have been known to adhere to surfaces particularly unstained steel, glass and gum elastic. Stainless steel is used extensively throughout the nutrient processing and the nutrient conveyance industry. As described by Ortega et Al ( 2009 ) , unstained steel is most widely employed due to its mechanical strength, corrosion opposition and easiness of fiction . Despite looking smooth to the unaided oculus, when chromium steel steel is viewed under the microsco pe it is shown to be really unsmooth with many distinguishable defects. These defects are thought to harbor bacterial cells which with the add-on of H2O and foods would heighten the micro-organism s endurance ( Moore and Griffith 2002 ) . There have been limited surveies on the adhesion behavior on Escherichia coli on chromium steel steel. Ortega et Al ( 2009 ) stated 108cfu/ml of civilization on chromium steel steel for 2 H at 20à °C was under the sensing bound. In contrast another survey suggested 105cfu/cm2 were found on chromium steel steel after vouchers were inoculated with 108cfu/ml at 4 à °C for 24 H. 1.3 Sampling of surfaces with swabs and sponges. Harmonizing to Hall and Hartnett ( 1964 ) , a simple convenient sample process would be utile to trace path of infection , for the identification of human bearers, rating of decontamination processs and bacteriological surveillance of the environment which could hence take to in-service preparation of forces concerned with sanitation . Surface sampling is going progressively of import and legion probes have been afoot to happen a simple, dependable, bacteriological trial to find, quantitatively, the healthful quality of environmental, nutrient and hand-contact surfaces. ( Angelotti et al 1958 ) . Cleaning agendas in the nutrient industry are designed chiefly to cut down both nutrient dust and to decrease microorganisms to degrees that pose small or low hazard to both safety and the quality of the merchandise. ( Moore and Griffith 2002 ) Traditional swabs are made from a wooden or plastic shaft with cotton, rayon, Dacron, or alginate fibers which are spun organizing a bud at one terminal. Moore and Griffith ( 2007 ) discourse how the wetting agents applied to swabs have dramatic effects on the sum of bacteriums recovered from a surface. The chief points to be assessed in finding how effectual peculiar swab types are depend on the remotion of bacterial contaminations from a surface, the release of these bacteriums from the swab bud and the subsequent cultivation . It was found that cotton swabs absorbed more liquid than other swabs evaluated. When bacteriums were recovered from wet surfaces it was apparent that coppice textured, Rayon and Dacron tipped swabs removed a significantly fewer CFU s compared to the cotton swabs. It was shown how cotton swabs performed every bit every bit good when trying a dry surface. Moore and Griffith ( 2007 ) province that cotton swabs consist of a secondary wall that is made up of cellulose. This enables the cotton to swell when positioned in wetness to ensue in an increased soaking up of liquid together with bacteriums entrapped indoors. These positive features that enable cotton swabs to take high degrees of bacteriums from a surface are thought to impede the swabs release of the bacterium. It can be predicted that the usage of a swab with a hapless initial absorbency could later ensue in a higher overall bacterial recovery with the assistance of dilutants to ease bacterial release. Moore and Griffith ( 2007 ) besides discuss how it was apparent upon go forthing the swabs at room temperature for 24 H that the release of bacteriums from the cotton swab was greater than other swabs. It was apparent that the bacterium became entrapped within the cotton fibres hence protecting the bacterium and assisting to make a microenvironment enabling the bacterium to last. In contrast to Moore and Griffith ( 2007 ) statements, Copan Italia ( 2010 ) shows how unfastened cell froth swabs have good release of the bacteriums but demonstrated soaking up of 3-5 times less than in traditional fiber swabs due to their construction ( Figure 1 ) . The development of Flocked swabs which have good releasing belongingss and can absorb five times more than cell froth swabs are widely used in clinical nosologies but have nt been applied yet to the recovery of Enterobacteriaceae throughout the nutrient industry. 1.4 Biochemical trials for the sensing and quantification of Enterobacteriaceae and their restrictions. Current biochemical and civilization based checks tend to be cheap and comparatively simple nevertheless there are restrictions with such trials. One of the chief restrictions includes the length of clip that is needed for the sensing and numbering of bacteriums. False- positive consequences, the loss of viability of bacteriums from aggregation to its numbering and the deficiency of growing of feasible yet non cultural bacteriums have been associated with current biochemical and civilization based checks. ( Rosrak and Colwell 1987 ) Today the Gram discoloration process is of common usage in research labs as the first method of designation for a micro-organism. The method was originally published in 1883 by Hans Christian Gram. This technique nevertheless is nt ever demonstrative of true Gram nature. Some Gram positive bacteriums may stain Gram negative due to cell wall harm in the bacteriums by over exposure to O. ( Bahrani Mougeot et al 2008 ) Blackburn ( day of the month? ) stated that the proving for enteral pathogens such as Salmonella requires specific methods that are labour intensive and can take several yearss to finish. Furthermore, infective bacteriums in nutrient are frequently non homogeneously distributed and are present in low Numberss doing sensing hard. Many nutrient production sites chiefly prefer to prove for enteral pathogens in external research labs while the testing of E.coli and Enterobacteriaceae are routinely tested to supply convenient appraisal of possible fecal taint. Many methods published from International Organisation for Standardisation ( ISO ) methods are available, where many processs of sensing are quantitative. The bulk of nutrient makers impose acceptable bounds for a given micro-organism. The Most Probable Number ( MPN ) technique from ISO 4831:2006 ( ISO 2010 ) and plating utilizing pour or spread technique are chiefly used. Violet Red Bile Glucose Agar ( VRBGA ) and Violet Red Bile Agar ( VRBA ) incorporating lactose have been deemed the most popular media for analyzing nutrients for Enterobacteriaceae. Their sensing and numbering are based chiefly on their ability to bring forth acid and gas from the agitation of glucose and milk sugar which is detected by the pH index impersonal ruddy. An sheathing is recommended to guarantee agitation of the saccharides and to cut down the hazard of oxidization every bit good as bettering the specificity of these media and later cut downing intervention from background vegetations or motile strains ( Blackburn day of the month? ) . There has been grounds that non Enterobacteriaceae bacteriums can turn on VRBA and VRBGA hence proposing that this method can impede specificity. The growing of Aeromonas spp has been detected on VRBGA harmonizing to Petzel and Hartman ( 1985 ) and VRBGA has been seen to be insufficiently selective bespeaking 52.4 % of consequences obtaine d to be false- positive ( Wook Oh and Kang 2004 ) MPN methods can supply greater sensitiveness compared with plating techniques when the taint degrees are low. However if the concentration of taint is high the consequences show greater fluctuation and may take to false positive consequences. MPN technique consists of multiple tubings of different media including Buffer Peptone H2O, Enterobacteriaceae enrichment stock. ( See figure 2 ) Enterobacteriaceae are oxidase negative and this trial is used to prove for the presence of the enzyme cytochrome oxidase to corroborate presumptive settlements in correlativity with glucose agar trial which tests for agitation of glucose. If agitation occurs it consequences in abundant production of acerb terminal merchandises ensuing in a color alteration. This method required by ISO described by Rose et Al ( 1974 ) has low preciseness and inordinate clip is necessary for analysis runing from 5-7 yearss. APIaââ¬Å¾? designation systems from Biomerieux are used widely throughout research labs. ID32E, is a standardized system in which the designation of Enterobacteriaceae and other not fastidious Gram negative bacteriums can be quickly identified. Many surveies have been reported utilizing API as method of designation including those of Drudy et Al ( 2006 ) and Galani et Al ( 2007 ) . The API/ID32E sensing kit is the most extended of the scope of API merchandises available. It includes 15 designation systems covering all groups of bacteriums encountered in industrial microbiological research labs ( BioMerieux, 2010 ) . The dependability of APIaââ¬Å¾? designation systems it used throughout industries. Janda et Al ( 2001 ) stated nevertheless that the trials included in the API 20E strip in 1975 were still the same in 2001 even if the Numberss of taxons in the Enterobacteriaceae household has increased well between those old ages. The ready to utilize Petrifilm system has been released by 3M health care for the sensing of foodborne pathogens. It s easy to utilize technique comprises a selective media under a transparent movie ( 3M health care ) . The media is hydrated by the add-on of bacterial suspension and after incubation seeable settlements can be counted. ( Blackburn? ? ) Despite this method being speedy and convenient, Petrifilm systems are expensive. Restrictions of this technique discussed by Mueller et Al ( 2009 ) show that some settlements shown on Petrifilm are excessively little to see from bare oculus. Therefore the usage of magnification for accurate visual image is required. It was shown that some beings can liquefy the gel on the movie leting spreading of growing and subsequent harm to other bing settlements supplying a lower count of settlements. Standard methods such as conventional civilization and biochemical based checks used to recite necessitate 18-24 H for consequences to be obtained. Progresss in modern molecular biological science have seen the development of molecular checks such as the polymerase concatenation reaction ( PCR ) that have become highly dependable and important in the sensing of bacterial species ( Khan et al 2007 ) . 1.5 Alternate DNA- based method for the sensing and quantification of Enterobacteriaceae 1.51 DNA extraction The rules of DNA extraction as discussed by Jordan ( 2008 ) include the debasement of microbic cell wall to let go of the Deoxyribonucleic acid and to sufficiently take sample constituents which can cut down assay efficiency and degrade the Deoxyribonucleic acid. Due to the complexness of nutrients matrices there are many inhibitors of DNA extraction including saccharides, fats, proteins, metal ions, phenoplasts and cell dust. 1.52 Polymerase Chain Reaction Polymerase Chain Reaction ( PCR ) is one of the most widely used molecular biological science techniques in the research lab. This is due to its specificity, flexibleness, singular velocity and its resiliency ( Mc Pherson et Al 1995 ) . PCR was developed in the 1980 s and the technique has been continuously improved and modified to spread out its versatility and pertinence . This Deoxyribonucleic acid based method has become an indispensable and day-to-day performed experimental technique in many research Fieldss and clinical research labs to observe infective agents, to magnify familial stuffs from limited volumes of DNA sample ( Aà µl ) and for cloning for sensing of familial look degrees. ( Yang et al 2005 ) . PCR is utile for both the diagnosing and direction of a assortment of infective diseases. ( Louis et al. , 2000 ) PCR Mix: PCR mix is made up of DNA polymerase, a forward and a contrary primer, bases, a DNA Target and PCR buffer with MgCl2. PCR stairss PCR elaboration can turn a few molecules of a specific mark nucleic acid into a mcg of DNA. Roche PCR Applications Manual ( 2006 ) explained how the procedure of PCR occurs in three chief stairss of 1 ) Denaturation, 2 ) Annealing and 3 ) Extension with the usage of temperature cycling ( figure 3 ) . Denaturation occurs at 90à °C when heat separates double stranded DNA into two individual strands. Since the H bonds associating the bases to one another are weak they break at such high temperatures, whereas the bonds between the deoxyribose and phosphates which are strong covalent bonds remain integral. The end of PCR procedure is non to retroflex the full strand of Deoxyribonucleic acid but to retroflex a mark sequence of about 100-35,000 base brace that is alone to the being. Primers are used to specify the terminals of that sequence. Primers are short, man-made sequences of single- stranded DNA typically dwelling of 20-30 bases. The annealing measure takes topographic point between 40à °C to 65à °C depending on the length on the length and sequence of the primers. This allows the primers to temper specifically to the mark sequence. Once the primers anneal to the complementary DNA sequences, the temperature is raised to about 72à °C and DNA polymerase begins to synthesise new dual stranded Deoxyribonucleic acid molecules that are indistinguishable to the original mark DNA. It does this by easing the binding and connection of complementary bases that are free in solution ( dNTPs ) . Synthesis ever begins at the 3 terminal of the primer and returns entirely in the 5 to 3 way. The new synthesis efficaciously extends the primers, making a complementary two-base hit stranded molecule from a single-stranded templet. After the PCR procedure is complete, cataphoresis must be completed in order to For the sensing of bacteriums within nutrients the mechanism of PCR has proved to be really effectual. Low degrees of 3cells of Campylobacter were found in meat samples utilizing this technique ( Waage et al 1999 ) . However During PCR elaboration, short Deoxyribonucleic acid sequences are copied at each rhythm. Theoretically the sum of Deoxyribonucleic acid at each rhythm should duplicate at each rhythm, ensuing in an exponential elaboration of the initial mark DNA. Fraga et Al ( 2009 ) demo how this is potentially true during the early phases of the reaction when the constituents present in PCR are in huge extra compared to the mark sequence. As the merchandise accumulates, the substrates become low ensuing in suppression. In order to look at the efficiency of the reaction, PCR can be divided into three distinguishable stages: exponential, additive and tableland. The first stage is exponential stage in which the reaction is 100 % efficient with the doubling of merchandise at each rhythm. As the amplicon exponentially accumulates in measure the PCR constituents are used up and the primers begin to vie with the amplicon and the reaction efficiency later decreases. As the reaction slows down the additive stage begins. The merchandise formed in this stage is extremely variable due to the rate at which peculiar constituents are depleted and the accretion of merchandises. The tableland stage is when the reaction Michigans due to depletion of substrates and the suppression of merchandises. There is an highly big difference between the additive stage and the concluding sum of merchandise produced. In conventional PCR, sensing of PCR merchandise is completed late in the additive stage or at plateau stage. As seen in figure 5 there can be a distinguishable difference in the two stages demoing that conventional PCR is variable when it comes to quantitative consequences. 1.42 Real clip PCR The development of existent clip quantitative PCR ( QPCR ) presents more rapid, specific and quantitative numbering of peculiar mark cistrons as they are amplified in existent clip. In existent clip PCR the sum of merchandise formed is monitored during the class of the reaction by supervising the fluorescence of dyes or investigations introduced into the reaction that is relative to the sum of merchandise formed, and the figure of elaboration rhythms required to obtain a peculiar sum of DNA molecules is registered. ( Kubista et al 2006 ) . Real clip PCR checks are characterized by a broad scope of quantification of 7-8 logarithmic decennaries, high proficient sensitiveness, high preciseness and it does nt necessitate any station PCR steps hence the hazard of taint is reduced. ( Klein D 2002 ) Real clip PCR processs follow the same rules of conventional PCR in the readying of mixes and cycling of temperature. This rapid sensing method uses a sensing format, normally a fluorescent dye that binds to the PCR merchandise. The sum of fluorescence generated is relative to the sum of PCR merchandise formed. Initially the signal is weak and hence indistinguishable from the background but as the PCR merchandise accumulates, the fluorescence can be acquired by the existent clip PCR device. A threshold line is developed by the existent clip device and the CT value is determined. CT value is the figure of rhythms required to make fluorescent threshold. Real clip PCR generates a CT value for each DNA sample which is hence relative to the transcript figure DNA. Normally used fluorescent Reporters SYBR Green 1. Asymmetric cyanine dyes such as SYBR Green 1 have two aromatic systems incorporating N, one that is positively charged connected by a methine span. The dye has virtually no fluorescence when free in solution due to quivers prosecuting both aromatic systems, which convert electronic excitement energy into heat that dissipates to the environing dissolver. When the dyes bind with DNA they emit fluorescence. ( Nygren et al 1998 ) As disussed by LightCycler Rea clip PCR Systems ( 2009 ) , SYBR Green binds to all double stranded Deoxyribonucleic acid molecules irrespective of the sequence. When it comes into contact with dual stranded Deoxyribonucleic acid its fluorescence additions significantly. Harmonizing to Monis et Al ( 2005 ) SBYR Green 1 has a restriction in dye stableness and dye dependent PCR suppression and the selective sensing of amplicons during DNA runing curve analysis. HYBRIDISATION PROBES HYDROLYSIS PROBES TAQMAN PROBES LUX PRIMERS SYBR Green 1 is normally used in existent clip PCR. However, these asymmetric dyes nevertheless are considered sequence non-specific newsmans in real-time PCR. They tend to breathe fluorescence signal to all double stranded DNA even unwanted primer-dimer merchandises. Primer dimer merchandises interfere with the formation of specific merchandises due to competition of the two reagents and may take to wrong readings. Melting curve analysis can easy recognize primer-dimer formation. Temperature is increased and fluorescence is measured as a map of temperature. As temperature additions, fluorescence lessenings due to increased thermic gesture. When dual stranded DNA separates an disconnected bead in the fluorescent signal occurs. Since primer-dimers are shorter and they tend to run at a lower temperature, they are easy recognised in runing curve analysis. Light Upon Extension ( LUX primer ) : based on oligonucleotides labelled with a individual fluorophore. They do non necessitate a quencher mediety includes a single-labeled primer with a FAM fluorophore at the 3 terminal in a hairpin construction and a corresponding unlabelled primer, designed to amply the 5 terminal of the cistron encoding the S protein ofTGEV. The constellation of the labelled primer enables the fluorescence slaking capableness. When the primer is incorporated into double-stranded RT-PCR merchandise, the fluorophore is dequenched, ensuing in a important addition in fluorescent signal Unlike the current good known real-time engineering that relies on a man-made DNA investigation labeled with two different fluorescent dyes, LUX primers engineering does non necessitate an expensive investigation so is more suited for everyday research lab diagnosing. What a LUX check demands is a specific primer set with a individual labeled, self-quenched primer and a corresponding unlabelled one, it is more dependable than the real-time method usingDNA bindingdyes that may bring forth potentially deceptive consequences due to the deficiency of specificity of the dyes. A old survey besides indicates that the LUX primers engineering is dependable for quantitation of cistron look and the consequence is similar to the probe-based quantitative check ( Brian et al. , 2003 ) . LUX fluorogenic primers can be designed and ordered via online package. The LUX check besides has the advantage of addition velocity and is less arduous over the gel-based RT-PCR technique that is presently the everyday cistron analysis tool forTGEV. The LUX assay took less than an hr to finish the elaboration reaction and the procedure was viewed in existent clip, while conventional RT-PCR methods normally take more than 1h for cistron elaboration and half an hr or more to run the gel and analyze the consequence. The advantage of velocity of the LUX check is more evident when compared to other everyday diagnostic methods for TGE Furthermore, the LUX check is closed-tube and one-step technique, which reduces the hazard of taint and reaction variableness. This sensitive and specific trial complements bing cistron methods for the sensing ofTGEV. The method shall turn out to be a valuable tool in the research lab diagnosing ofTGEV, particularly as a agency of corroborating positive consequences from serological trials. LUX primers engineering supports manifold elaboration ( hypertext transfer protocol: //www.invitrogen.com/lux ) that makes observing different pathogens in a individual check possible. By utilizing two sets of primers, each labeled with a different dye, a individual LUX check can observe two different viruses. LUX primers are compatible with a broad assortment of real-time PCR instruments ( hypertext transfer protocol: //www.invitrogen.com/lux ) . More checks can be developed for the sensing of other pathogens. By cut downing the cost of real-time cistron sensing and with high public presentation, LUX fluorogenic primers engineering may has the possible to be used widely in the field ofanimal diseasesurveillance and control every bit good as import and export carnal quarantine direction. Advantages of utilizing DNA for microbic Testing Deoxyribonucleic acid is stable and unswayed by environmental factors while being independent from bacterial fundamental law doing consequences conclusive non subjective. It is accurate due to species specific mark sequence which is unattainable with cultural methods and public presentation controls can be added. There are good established DNA sensing methods available which enable fast sensing. Reliable industry of primers and investigations. 2.1 Preparation of Deoxyribonucleic acid from bacterial strains The undermentioned Enterobacteriaceae strains were obtained ( MicroBioLogics Inc, Minnesota, USA ) Escherichiacoli ( ATCC 11775 ) , Serratiamarcescens ( ATCC 13880 ) , Enterobacteraerogenes ( ATCC 13048 ) , Salmonella typhimurium ( ATCC 13311 ) Erwinia persicina ( ATCC 1381 ) Shigella flexneri ( ATCC 9199 ) Klebsiella pneumonia ( ATCC 700603 ) , Yersinia enterocolitica ( ATCC 9610 ) Listeria monocytogenes ( ATCC 19115 ) , Vibrio parahaemoliticus ( ATCC 17802 ) , Aeromonas hydrophila ( ATCC 7966 ) and Campylobacter jejuni ( ATCC 29428 ) . The University of Limerick supplied the strains Cronobacter sakazakii, Enterobacter cloacae, Pseudomonas aeruginosa and Proteus Mirabilis. The National Collection of Type Cultures ( Health Protection Agency Culture Collections, Salisbury, UK ) supplied Staphylococcus aureus ( NCTC 8325 ) . All strains of bacteriums were stored on Protect beads 109 ( LangenBach services Ltd, Dublin, Ireland ) at -20à °C until cultivation. All Enterobacteriaceae strai ns grown on alimentary agar ( NA ) ( Oxoid, Basingstoke, UK ) at 37à °C for 24hr Aà ± 2 hour except Erwinia persicina which was grown at 30à °C, Listeria monocytogenes and Staphylococcus aureus grown at 37à °C. Vibrio parahaemoliticus grown at 35à °C on Trypic soybean agar ( TSA ) ( Oxoid ) Confirmation and Identification of the mention micro-organism E coli. The designation of Escherichia coli ( ATCC 11755 ) was verified by the undermentioned biochemical trials. The Gram discoloration process was applied to a settlement from the fresh civilization on NA. Oxidase trial was carried out utilizing oxidase strips ( bioTRADING, Dublin, Ireland ) . A positive control of Pseudomonas aeruginosa and a negative control of Staphylococcus aureus were used to corroborate the dependability of the trial. API designation utilizing ID 32E was carried out harmonizing to maker s instructions ( BioMerieuxAà ®S.A, Craponne, France ) and identified utilizing the package Apiweb ( BioMerieux ) 2.2 Preparation of bacterial suspension. Pre-cultures were prepared by infixing a loop full of bacterial settlement into Nutrient Broth ( Oxoid ) with incubation of 37à °C for all Enterobacteriaceae with the exclusion of Erwinia persicina which was grown at 30à °C, Listeria monocytogenes and Staphylococcus aureus grown at 37à °C. A loop full of Vibrio parahaemolyticus was grown at 35à °C on Tryptic Soya Broth ( TSB ) ( Oxoid ) In peculiar the growing of Escherichia coli in alimentary stock was studied by mensurating the optical denseness and home base numeration. Spectrophotometric measurings were obtained at 600nm utilizing ( insert name here ) .Optical denseness was acquired every 30min from 0min to 4h 30min 2.3 Usual spiking of vouchers and recovery by swobing. Stainless steel vouchers of class 304 were obtained. Regions to be spiked with Escherichia coli were indicated utilizing a templet ( ) ( 10cm x 10cm ) . Each voucher was spiked by pipetting 100Aà µl of Escherichia coli civilization onto the surface and utilizing a spreader ( ) . After allocated clip ( 0min 30min or 60min ) , vouchers were swabbed utilizing cotton swab. Each voucher was swabbed twice: horizontally and vertically. Each swab was cut and placed into the interior tubing of swab extraction tubing system ( SETS ) ( Roche Diagnostics, Mannheim, Germany ) .Each aggregation tubing was later centrifuged at 10000g for 10min ( Sigma1-15 ) . Then the inner tubings and the supernatants were discarded. Pellets were re-suspended in 250Aà µl Ringer one-fourth strength solution ( Oxoid ) . Dilution series in one-fourth strength toller solution were prepared, plated out on alimentary agar and incubated 18-24h at 37à °C. 2.4 Study of the release of Bacteria from different swabs and sponges. Comparative survey of the recovery of Escherichia coli cells was performed utilizing cotton, rayon and alginate swabs. ( Copan Italia S.p.A, Brescia, Italy ) . 100Aà µl of 18h Escherichia coli civilization were deposited straight onto each swab. Swabs were cut and placed into SETS tubes. Tubes were centrifuged at 10000 g for 10 min. Pellets were re-suspended with 200Aà µl of quarter-strength Ringer Solution ( Oxoid ) . Dilution series were made and 100 Aà µl of diluted sample were plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37à °C for 24 H. Large sponges ( Medical Supply Co Ltd, Dublin, Ireland ) were tested to retrieve bacteriums from surfaces by swobing after allocated clip ( 0 min, 30 min, 60 min ) . Each sponge impregnated with 10ml Maximal Recovery Diluent ( MRD ) ( Oxoid ) was inserted into a stomacher bag ( ) supplemented with 100ml of MRD and stomached utilizing stomacher ( ) for 120 s at high power. Dilution series were made and 100Aà µl of diluted sample was plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37à °C for 24 H 2.5 Detection and Quantification of feasible bacteriums from surfaces. Plate numeration expression was obtained as per ISO 4833:1991 ( Harrigan W.F 1998 ) which has since been renewed to ISO 4833:2003 Microbiology of nutrient and animate being eating materials Horizontal method for the numbering of micro-organisms Colony-count technique . The home base numeration expression was? c/ ( n1 + 0.1 n2 ) vitamin D where? degree Celsius was the amount of all settlements counted on all dishes, n1 was the figure of dishes in 1st dilution, n2 was figure of dishes in 2nd dilution and vitamin D represented the dilution. Miles and Misra method as per Harrigan W.F ( 1998 ) was used in peculiar when proving recovery of Escherichia coli from the big sponges. 2.10 Bacterial designation of bacteriums in the suspension used to make the unreal nutrient environment on surfaces. The suspension was prepared from 34 swabs samples that were collected from nutrient contact surfaces in Dawn Fresh Food Company, Fethard, Co. Tipperary. Each swab was assorted with 0.1 % peptone H2O ( Oxoid ) and the suspension were pooled together to make one chief suspension that was assorted with half volume glycerol 50 % ( Sigma Aldrichaââ¬Å¾? Inc ) . This suspension was aliquoted into 1ml eppendorf tubings and maintain in at -80à °C. A entire feasible count was determined by utilizing the Miles and Misra method and later by home base numeration following a dilution series of bacterial suspension. The sensing of Listeria monocytogenes, Staphylococcus aureus and the Enterobacteriaceae were targeted. In the instance of Listeria monocytogenes 1ml of sample was dispensed into 9ml Buffer Peptone H2O ( Oxoid ) . Incubate 37à °C for 18-24hours. After 24 H transportation 10ml from tubing into 90ml of Listeria Enrichment stock ( Oxoid ) , incubate for 48 H at 30à °C guaranting agitation. After 48 h a loop full of solution was streaked on a Listeria agar home base ( Oxoid ) and incubated for 48 H at 30à °C. Listeria Petrifilm ( 3Maââ¬Å¾? , Dublin, Ireland ) was used following maker s instructions. For the designation of Staphylococcus 100Aà µl of unreal nutrient environment was plated on baird Parker agar ( Oxoid ) administering the organic burden throughout the home base utilizing a spreader and incubated at 37à °C for 48 h. After 48 h agglomeration was tested utilizing PastorexAà ® Staph Plus trial. ( Biorad ) . Catalase activity was tested by the add-on of H2O2 ( ) . Each suspected Staphylococcus aureus settlement was placed in 1ml of toller solution that was later pipetted on to Staph Petri movie ( 3Maââ¬Å¾? ) . Petri movie was placed in brooder for 24 H at 37 à °C. Enterobacteriaceae was detected utilizing most likely figure ( MPN ) See appendix. 2.6 DNA extraction: For specificity for PCR checks, bacterial pellets were obtained antecedently from civilizations in exponential growing stage were used with the exclusion of Camplyobacter jejuni. One settlement of C.jejuni was resuspended in 0.1 % Peptone H2O ( Oxoid ) and centrifuged at 5000 g for 5 min. For the quantification of bacteriums from surfaces, pellets were recovered from SETS after centrifugation of 1ml of civilization at 5000 g for 5 min. A rapid purification of DNA samples utilizing DNeasy Blood and Tissue Kit ( Qiagen, West Sussex, UK ) was preformed following maker s instructions. Deoxyribonucleic acid was extracted, purified and later quantified utilizing Nanodrop ND 1000 spectrophotometer ( ThermoScentific, Wilmington, USA ) Deoxyribonucleic acid concentrations were adjusted to 1ng per 2Aà µl 2.7 Choice of Primer sets. 2.7-1 ENT Primers ENT primers developed by Nakano et Al ( 2003 ) and designed to temper to the 16S rRNA cistron of Escherichia coli. The sequence of the forward primer: 5GTTGTAAAGCACTTTCAGTGGTGAGGAAGG 3was 425 through 454 in the E. coli 16S rDNA while the sequence of the contrary primer 5GCCTCAAGGGCACAACCTCCAAG 3 had places 826 through 848 in the E.coli 16S rDNA. ENT primers expected to take to formation of 419-425 bp of PCR merchandise. 2.7-2 IEC primers: IEC primers as described by Khan et Al ( 2007 ) are oligonucleotide primer braces derived from the distal and proximal conserved flanking parts of the16S rRNA cistron, the Internal Transcribed Spacer ( ITS ) part and the 23S rRNA.IEC frontward primer 5CAATTTTCGTGTCCCCTTCG 3 and change by reversal primer 5GTTAATGATAGTGTGTGTCGAAAC 3 had expected PCR merchandise length of 450bp. 2.8 PCR Conditionss For a individual PCR 25 Aà µl PCR reaction, PCR maestro mixes were prepared with unfertile DNA H2O, PCR buffer 2mM MgCl2, 25mM MgCl2, a dNTP mixture ( dATP, dTTP, dCTP, dGTP ) , frontward primer, change by reversal primer, DNA polymerase and 2Aà µl of peculiar DNA. PCR was carried out on G-STORM GS2 Thermal Cycler. ( Familial Research Instrumental Ltd, Braintree, UK ) . The elaboration conditions were as follow: stopping point palpebra and heated to 111à °C, 95à °C for 6 min, bacterial rhythm start of 28ycles, denaturation measure of 95Aà °C for 30 s, tempering temp between gradient of 56-62Aà °C depending on primer type for 15 s, elongation for 30 s at 72à °C. End rhythm with elongation for farther 7 min at 72à °C. Cycle was repeated 30 times. 2 % Agarose gel ( Biosciences, Dun Laoghaire, Ireland ) pre-stained with SYBR Safeaââ¬Å¾? ( Molecular Probes, Eugene, USA ) cataphoresis was run in Tris ethanoate EDTA ( TAE ) . ( Sigma Aldrichaââ¬Å¾? Inc, Saint Louis, USA ) with Amplisize ( Biorad, Hercules, USA ) as a molecular marker runing from 50 to 2000 bp. The gel was examined in G-BOX ( Syngenes, Cambridge, UK ) under UV visible radiation. Recovery of E coli in the presence of an unreal nutrient environment Innoculum was prepared with pre-culture at the exponential stage when the concentration was 108cfu/ml. 100Aà µl was pipetted onto chromium steel steel vouchers incorporating different concentrations of unreal nutrient environment ( high, medium or low concentrations ) . After allocated clip ( 0 min, 30 min, 60 min ) vouchers were swabbed at 90à °angle. Swabs were cut into SETS ( Roche Applied Science ) and centrifuged for 10 min at 6000g. Pellet was re-suspended with 150Aà µl toller solution leting 50Aà µl for EMA intervention and 50Aà µl for home base numeration. Preparation of Propidium monoazide ( PMA ) PMA dissolved in 20 % DMSO to obtain a stock concentration of 20nM and stored at -20à °C off from the visible radiation. 1.25Aà µl PMA solution added to 500Aà µl of civilization aliquots to give a concluding concentration of 50nM following the incubation period of 5minutes in the dark with occasional commixture to let the PMA to perforate the dead cells and to adhere to the DNA. Samples are so put in ice and placed 20cm from 500W halogen visible radiation beginning for 15minutes. Samples centrifuged at 10,000g for 10 proceedingss. Samples washed with NaCl ( ) and MilliQ H2O ( ) in order to take the inactivated PMA. Bibliography. Angelotti R, Foter M.J, Busch K.A, Lewis K.H ( 1958 ) . A comparative rating of methods for finding the bacterial taint on surfaces Public Health Report 79 ( 11 ) pp 1021-1024 available: PubMed database [ accessed 10 March 2010 ] Astrographics ( 2002 ) Escherichia coli bacteria [ image online ] , available: hypertext transfer protocol: //www.astrographics.com/GalleryPrintsIndex/GP2144.html [ assessed 10 March ] Becker, B. , Weiss, C. , Holzapfel, W.H ( 2008 ) An rating of the usage of three phenotypic trial systems for biochemical designation of Enterobacteriacea and Pseudomonadacea Food Control 20 ( 9 ) available: Science Direct [ accessed 13 Feb 2010 ] Bej, A.K. , Steffan, R.J. , DiCesare, J. , Haff, L. , Atlas, R.M. , ( 1990 ) Detection of coliform bacteriums in H2O by polymerase concatenation reaction and cistron investigations. Applied Environment Microbiology 56 pp 307-314 Biomerieux Industry ( 2010 ) APIAà ®ID32E [ online ] available: hypertext transfer protocol: //www.biomerieux-industry.com/servlet/srt/bio/industry-microbiology/dynPage? open=NDY_IND_FDA_PRD A ; doc=NDY_FDA_PRD_G_PRD_NDY_17 A ; pubparams.sform=0 A ; lang=en [ accessed 19 March 2010 ] Bahrani- Mougeot F.K. , Paster, B.J. , Coleman, S. , Ashar, J. , Knost, S. , Sautter, R.L and Lockhart, P.B ( 2008 ) Designation of unwritten bacteriums in blood civilizations by conventional versus molecular methods Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontology 105 ( 6 ) pp 720-724. Available: Science Direct [ accessed 11 March 2010 ] Copan Italia ( 2010 ) Why flocked swabs are superior to fibre cloaked swabs and froth swabs and how they can better infective disease nosologies , [ online ] , available: hypertext transfer protocol: //www.mls.be/nieuwsbrieven/css/Why-Flocked-Swabs-are-Superior-to-Fiber-and-Foam.pdf [ accessed 30 Feb 2010 ] Denton, M ( 2007 ) Enterobacteriaceae International Journal of Antimicrobial Agents 29 ( 3 ) available: Science Direct [ accessed 24 Feb 2010 ] Drudy D, O Rourke M, Murphy M, Mullane N.R, Kelly L, Fischer M, Sanjaq S, Wall P, OMahony M, Whyte P, Fanning S ( 2006 ) Characterisation of a aggregation of Enterbacter sakazakii isolates from environmental and nutrient beginnings International Journal of Food Microbiology 110 ( 2 ) pp 127-134 available: Science Direct database [ accessed 18 March 2010 ] Food Market Exchange ( 2001 ) HACCP Hazard Analysis Critical Control Point [ online ] available: hypertext transfer protocol: //www.foodmarketexchange.com/datacenter/laws/detail/dc_lr_reference_haccp [ accessed 17 Feb 2010 ] Galani I, Rekatsina P.D, Hatzaki D, Plachouras D, Souli M, Giamarellou H ( 2007 ) Evaluation of different research lab trials for the sensing of metalo-?-lactamase production in Enterobacteriaeae , Journal of Antimicrobial Chemotherapy 61 pp 548-553 Grant, M.A. , Weagent, S.D. , Feng, P ( 2001 ) Glutamate decarboxylase cistrons as a pre-screening marker for sensing of Escherichia coli groups Applied Environment Microbiology 67 pp 3110-3114 Griffith C.J, Davidson C.A, Peters, A.C and Fielding, L.M ( 1997 ) Towards a strategic cleansing assessment programme: hygiene monitoring and ATP luminometry, an options assessment Food Science Technology Today 11, pp 15-24. Hall L.B and Hartnett M.J ( 1964 ) Measurement of bacterial taint on surfaces in infirmaries Public Health Report 79 ( 11 ) pp 1021-1024, available: PubMed database [ accessed 24 March 2010 ] Horachova, K. , Mlejnkova, H. , Menjnek, P. , ( 2006 ) Direct sensing of bacterial fecal indexs in H2O samples utilizing PCR Water Science Technology 54 pp 135-140 Huang M.M, Arnheim N, Goodman M.F ( 1992 ) Extension of base mispairs byTaqDNApolymerase: deductions for individual nucleotide favoritism in PCR Nucleic Acids Research 20 ( 17 ) pp 4567-4573 Iqbal, S. , Robinson, J. , Deer, D. , Saunders, J.R. , Edwards, C. , Porter, J. , ( 1997 ) , Efficiency of the polymerase concatenation reaction elaboration of the uid cistron for sensing of Escherichia coli in contaminated H2O Lett Applied Microbiology 24 pp 498-502 Janda, J.M and Abbott, S.L ( 2001 ) Bacterial Designation for Publication: When is Enough, Enough? Journal of Clinical Microbiology 40 ( 6 ) pp 1887- 1891 Juck, D. , Ingram, J. , Prevost, M. , Coallier, J. , Greer, C ( 1996 ) Nested PCR protocol for the rapid sensing of Escherichia coli in drinkable H2O , Canadian Journal of Microbiology 42 862-866 Kang D, Eifert J.D, Williams R.C ( 2007 ) Evaluation of Quantitative Recovery Methods of Listeria monocytogenes Applied to Stainless Steel Journal of AOAC International 90 ( 3 ) Kenyon College ( 2010 ) , PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Kenyon College ( 2010 ) PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Khan, I.U.H. , Gannon, V. , Kent, R. , Koning, W. , Lapen, D.R. , Miller, J. , Neumann, N. , Phillips, R. , Robertson, W. , Topp, E. , Bochove, E. , Edge, T.A ( 2007 ) Development of rapid quantitative PCR check for direct sensing and quantification of culturable and non- culturable Escherichia coli from agiculture water partings Journal of Microbial Methods 67 pp 480-488 available: Science Direct [ assessed 13 March 2010 ] Kubista, M. , Andrade, J.M. , Bengtsson, M. , Forootan, A. , Jonak, J. , Lind, K. , Sindelka, R. , Sjoback, R. , Sjogreen, B. , Strombom, L. , Stahlerg, A. , Zoric, N. , ( 2006 ) The existent clip polymerase concatenation reaction Molecular Aspects of Medicine 27 pp95-125 available: Science Direct [ accessed 11 March 2010 ] .REVIEW Louie, M. , Louie, L and Simor, A. , E. ( 2000 ) . The function of DNA elaboration engineering in the diagnosing of infective diseases Canadian Medical Association Journal 163 ( 3 ) , pp 301-305 Mc Pherson, M. J. , Hames B. D, and Taylor, G. , R. , ( 1995 ) , PCR 2: A Practical Approach Oxford University Press, New York Microbiological hazard appraisal series 10 ( 2006 ) Enterobacter sakazakii and Salmonella in powdery baby expression, Google Books [ online ] , available: hypertext transfer protocol: //books.google.com/books? id=iHZSx2Wfe7EC A ; pg=PA76 A ; dq=enterobacteriaceae+in+food A ; as_brr=1 A ; cd=1 # v=onepage A ; q=enterobacteriaceae % 20in % 20food A ; f=false [ assessed 9 March 2010 ] Mossel D.A, Stryijk C.B ( 1995 ) Escherichia coli, other Enterobacteriaceae and extra indexs as markers of microbiologic quality of nutrient: advantages and disadvantages , Microbiologica 11 ( 1 ) pp 75-90. Available: Medline [ accessed 24 Feb 2010 ] Moore and Griffith ( 2002 ) Factors act uponing recovery of micro-organisms from surfaces by the usage of traditional hygiene swobing , Dairy, Food and Environmental Sanitation 22 ( 6 ) pp 410-421 Mueller, S.A. , Anderson, J.E and Byung, K ( 2009 ) Comparison of Plate counts, Petrifilm, Dipslides and Adenosine Triphosphate Bioluminescence for supervising bacteriums in chilling H2O armored combat vehicles , Water Environmental Research 81 ( 4 ) available: Wilson web [ accessed 24 March 2010 ] Nygren, J. , Svanvik, N. , Kubista, M. , ( 1998 ) The interaction between the fluorescent dye thiazole orange and DNA Biopolymers 46 pp 39-51 Ortega, M.P. , Hagiwara, T. , Watanabe, H. , Sakiyama, T. ( 2009 ) Adhesion behavior and removability of Escherichia coli on chromium steel steel surface Food Control 21 ( 4 ) pp 573-578 available: Science Direct [ accessed 13 March 2010 ] Reilly W.J. , Forbes, G.I. , Sharp, J.C.M. , Oboegbulem, S.I. , Collier, P.W and Paterson, G.M ( 1988 ) Poultry- Borne Salmonellosis in Scotland , Epidermiology and Infection 101 ( 1 ) pp 115-122 Rose, R.E. , Geldreich, E and Litsky, W ( 1974 ) Improved membrane filter method for fecal coliform analysis , Applied Microbiology 70 ( 9 ) pp 5692 5694. Roche PCR Applications Manual ( 2006 ) 3rd ed. , Germany: Fanz and Neumayer Rosrak D.B, Colwell R.R ( 1987 ) Survival schemes of bacteriums in the natural environment Microbial Rev 51 pp 365-379. Tsen, H.Y. , Lin, C.K. , Chi, W.R. , ( 1998 ) Development and usage of 16S rRNA cistron targeted PCR primers for the designation of Escherichia coli cells in H2O Journal of Applied Microbiology 85 pp 554- 560 Van Acker, J. , De Smet, I. , Muyldermans, G. , Bougatef, A. , Naessens, A. , Lauwer, S. ( 2000 ) Outbreak of Necrotizing Enterocolitis Associated with Enterobacter sakazakii in Powered Milk Formula , Journal of Clinical Microbiology 39 ( 1 ) pp 293-297 Wook Oh, S and Kang, D.H ( 2004 ) , Fluorogenic selective and differential medium for isolation of Enterobacter sakazakii , Applied and Environmental Microbiology, 70 ( 9 ) pp 5692-5694. Yang I, Kim Y H, Byun J.Y, Park S.R ( 2005 ) Use of manifold polymerase concatenation reactions to bespeak the truth of theannealing temperature of thermic cycling Analytic Biochemistry 338 ( 2 ) available: Science Direct [ assessed 10 March 2010 ]
Subscribe to:
Post Comments (Atom)
No comments:
Post a Comment
Note: Only a member of this blog may post a comment.